Genetics and Molecular Biology
Sociedade Brasileira de Genética
image
Three Mexican Families with β thalassemia intermedia with different molecular basis
Volume: 42, Issue: 4
DOI 10.1590/1678-4685-GMB-2019-0032
  • PDF   
  • XML   
  •       
Abstract

Beta thalassemia (β-thal) is a frequent monogenic disease, is clinically and molecularly heterogeneous. This study described molecular and laboratory findings for three Mexican patients with β-thal intermedia phenotype and their relatives. Three Mexican families were studied for presenting β-thal intermedia, ARMS-PCR and Gap-PCR were performed to screen for common mutations, Sanger sequencing for rare or new alleles, and MLPA for identifying deletions and or duplications. In all three families we observed, in heterozygote condition, the mutation c.118C > T (p.Gln39*) also known as codon 39(C > T) in the β globin gene (HBB) associated with a novel molecular defect: a new duplication of the alpha globin gene cluster, a new deletion that includes the loss of exon 3 of HBB and finally a novel mutation in the 3’UTR of HBB (HBB: c.*132C > A). We report three Mexican families with beta thalassemia intermedia due to different molecular basis; a new single nucleotide mutation involving the last nucleotide of the β-globin chain transcript; and two possible new DNA rearrangements, an α cluster duplication, and a partial β gene deletion.

Keywords
de la Torre, Díaz, Cortés, López, López, Anzaldo, Torres, Gonnet, Badens, and Bonello-Palot: Three Mexican Families with β thalassemia intermedia with different molecular basis

Introduction

Beta thalassemia (β-thal) is one of the most frequent worldwide monogenic diseases, it is an autosomal recessive disorder, characterized by reduced (β+, β++) or absence (β0) of hemoglobin’s beta subunit (Thein, 2018). HBB gene mutations are the cause for this disease, to date there are near 300 reported β-thal alleles (http://globin.cse.psu.edu/), these mutations can be divided in three main groups: a) transcriptional mutations that include promoter regulatory elements or 5’ UTR; b) RNA processing mutations involving splicing junction, consensus and cryptic sequences, poly A signal and 3’ UTR; and c) translation mutations which include initiation codon substitutions, nonsense and frameshift mutations (Thein, 2018). Although single nucleotide mutations represent the vast majority of β-thalassemias, deletions involving HBB gene, or its regulating sequences have also been associated to this pathology (Patrinos GP et al., 2004). Despite being an autosomal recessive inherited condition, some forms of β-thal are inherited dominantly (βD alleles), so is the case of nonsense or frameshift mutations in exon three that result in the formation of a premature termination codon and therefore the production of unstable β-globin chains that precipitate along with the free α-globin chains in the erythroid precursor causing premature death and ineffective erythropoiesis (Thein, 2018; Rawa et al., 2017).

β-thal is classified according to severity as minor, major and intermedia (Thein and Wood et al., 2009; Thein, 2018). The minor form corresponds to the simple heterozygote condition whereas the beta-thalassemia major type refers to the more severe disorder with transfusion dependency as a result of the inheritance of two β0 alleles. β-thal intermedia comprises a wide range of clinical features and is mainly characterized by occasional blood transfusions; β-thal intermedia is observed in different molecular forms such as, two β-thal alleles (β0+/+, β00), one β-thal allele and additional copies of α-globin genes (β0A; ααα/αα, αααα/αα, αααα/ααα) or the presence of a single dominant β-thal allele (βDA) (Origa et al., 2014; Ben-Salah et al., 2017, Clark et al., 2018).

The pathophysiology of this disease is the outcome of an imbalanced ratio of α- and non-α-globin chains (excess of α-globin chains), and the severity depends on three different mechanisms. First, the type of β allele (β0, β+ or β++), correlated to the amount of residual β-globin chains (Mettananda et al., 2015; Ben-Salah et al., 2017; Shang and Xu 2017; Zhong et al., 2018). Second is the co-inheritance of alpha globin locus defect, either an alpha-thalassemia deletion (α-thal) which is often observed in β-thal patients, resulting as a positive modifier or, conversely, the presence of additional copies of HBA2 or HBA1 genes which causes a more severe form of β-thal (Ben-Salah et al., 2017; Theodoridou et al., 2018; Clark et al., 2018; Harteveld et al., 2008). And third is the presence of genetic variants associated with increased fetal hemoglobin (HbF) production. For instance, HBG2:c.-211C > T (Xmn1 -158C > T) a single nucleotide polymorphism in the HBG2 promoter is known to be a HbF inducer (Mettananda and Higgs 2018; Ngo and Steinberg 2015; Sripichai and Fucharoen 2016).

Beta thalassemic alleles have been previously studied in Mexican population, a total of 21 different mutations represent the molecular spectrum of this disease in Mexico (Rizo-de la Torre et al., 2017). The aim of this paper is to report for the first time three Mexican families with β-thalassemia intermedia due to the combination of the common allele (HBB: c.118C > T) and a novel molecular defect.

Subjects and Methods

Subjects

Three thalassemia intermedia patients and their families were included in this study.

Family 1 is composed by seven members originally from the state of Jalisco, the index case is a 25-year-old female. Family 2 is from Oaxaca and consists of a 5-year-old girl and her parents. Family 3 is from Guanajuato and composed of three members, a 28-year-old male and his two children.

All subjects signed informed consent for hematological, biochemical and molecular studies. All procedures were performed in accordance with the standards of the local ethics committee of the Instituto Mexicano del Seguro Social (Mexican Institute of Social Security) and with the 1964 Helsinki declaration.

Hematological and biochemical analysis

Peripheral blood (10 mL) was collected in EDTA tubes. The hematological data were obtained by electronic counter (ADVIA2120i; Siemens Healthcare, Erlangen, Germany); the biochemical analysis was performed by conventional methods (HbF by alkaline denaturation, HbA2 by microchromatography with diethylaminoethyl DEAE – cellulose–Sigma Aldrich and, electrophoresis in cellulose acetate) (Huisman and Jonxis, 1977).

Molecular analysis

DNA samples were isolated by salting-out procedure (Miller et al., 1988). The genotyping process comprises the routine thalassemia screening: ARMS-PCR for HBB known mutations (Old et al., 1990), gap-PCR for δβ-thalassemia Spanish type (Vives-Corrons et al., 1992) and common alpha-thalassemia deletions (Liu et al., 2000). Furthermore, HBB, HBA2 and HBA1 genes were analyzed by Sanger sequencing, using BigDye® Terminator kit v3.1 and Applied Biosystems 3500 Series Genetic Analyzer (Applied Biosystems); and multiple ligation-dependent probe amplification using SALSA® MLPA® probemix P102HBB and P140HBA following the manufacturer’s recommendations (MRC-Holland) for all the individuals described above.

Results

All three propositus were suspected of intermedia thalassemia. They exhibited mild to severe anemia, and unusual elevated HbF. We suspected the presence of at least two thalassemic alleles (α, β or δ), and/or hereditary persistence of fetal hemoglobin. Hematological, biochemical and molecular data are shown in Table 1.

Table 1
Hematological, biochemical and molecular data of three Mexican families with β-thal intermedia.
SubjectGender/AgeRBC (1012/L)Hb (g/dL)MCV (fL)MCH (pg)HbA2 (%)HbF (%)β Genotypeα Genotypeγ Genotype*
Family 1
I-1§M/483.010.5100.033.31.81.6βAAαααα/ααC/C
I-2F/465.110.665.520.83.32.2β39Aαα/ααC/T
II-1† (II-1†§)F/331.84.885.126.83.811.7β39Aαααα/ααC/C
II-2F/325.313.980.326.11.11.7βAAαααα/ααC/T
II-3F/253.16.266.120.33.86.7β39Aαααα/ααC/C
II-4F/213.37.470.922.42.117.9β39Aαααα/ααC/C
II-5M/194.614.793.232.12.21.6βAAαα/ααC/T
Family 2
I-1M/256.112.365.720.35.21.4β39Aαα/ααC/C
I-2F/255.310.265.019.14.96.7βdelAαα/ααC/T
II-1F/53.89.888.326.10.580.5β39delαα/ααC/T
Family 3
I-1M/283.67.182.019.97.88.7β39+132αα/ααC/C
II-1F/76.211.858.019.16.33.4β39Aαα/ααC/C
II-2M/14.210.776.725.23.68.4βA+132αα/ααC/C
RBC=red blood cells; Hb=hemoglobin; MCV=mean corpuscular volume; MCH=mean corpuscular hemoglobin; HbA2=hemoglobin A2; HbF=fetal hemoglobin; β39=HBB:c.118C > T; βdel=HBB 3’ deletion; β+132=HBB:c.*132C > A. Index cases are shown in bold. * = HBG2:c.-211C > T (Xmn1 -158C > T). † Transfused during sample collection. § Deceased after diagnosis.

Family 1

The proposita (II-3) and her two sisters (II-1 and II-4) presented a profile typical of thalassemia intermedia (Table 1) whereas the phenotype of her parents does not entirely resemble a β-thal carrier, despite both of them presented mild anemia. Microcytosis and hypochromia were only observed in her mother (I-2), who also had borderline HbA2. Her father presented macrocytosis, low HbA2 and normal HbF.

We found by Sanger sequencing the mutation HBB: c.118C > T (p.Gln39*) (or β39C > T) in heterozygous condition in her mother (I-2) and the three affected members (II-1, II-3 and II-4). The second molecular defect observed in the three affected patients was a large duplication in α cluster that includes the regulatory HS-40 region as well as the genes HBZ, HBPZ, HBM, HBPA1, HBA2 and HBA1: 16p13.3 (?-037132)_(167890-169744) (Figure 1A). This molecular defect was inherited from her father and transmitted to 4 members of the family (3 affected (II-1, II-3 and II-4) and one unaffected (II-2)). II-2 presented subnormal MCV and MCH (Table 1, Figure 1A).

Schematic representation of three globin gene mutations associated with
HBB.c:118C > T in patients with β-thal intermedia.
A) α-cluster duplication from Family 1. Duplication is shown in dark grey
shade, uncertain breakpoints are indicated in light grey shade; MCS-R
sequences are numbered from 1-4; involved MLPA probes are specified by (a)
463 bp 19236-L25316, (b) 283 bp 04638-L23602, and (c) 310 bp 04639-L04020.
B) HBB 3’ deletion from Family 2. Deletion is indicated in
dark grey shade, uncertain breakpoints are shown in light grey shade
involved MLPA probes are presented by (a) 196 bp 05833-L05335, (b), 166 bp
11884-L12684 (c) 206 bp 11885-L13080, (d) 173 bp 05836-L06321; (e) 274 bp
11980-L12803. C) HBB:c.*132C > A point mutation found in Family 3.
Nucleotide change is indicated with an arrow. Nucleotides in capital letters
represent transcribing sequence.
Figure 1
Schematic representation of three globin gene mutations associated with HBB.c:118C > T in patients with β-thal intermedia. A) α-cluster duplication from Family 1. Duplication is shown in dark grey shade, uncertain breakpoints are indicated in light grey shade; MCS-R sequences are numbered from 1-4; involved MLPA probes are specified by (a) 463 bp 19236-L25316, (b) 283 bp 04638-L23602, and (c) 310 bp 04639-L04020. B) HBB 3’ deletion from Family 2. Deletion is indicated in dark grey shade, uncertain breakpoints are shown in light grey shade involved MLPA probes are presented by (a) 196 bp 05833-L05335, (b), 166 bp 11884-L12684 (c) 206 bp 11885-L13080, (d) 173 bp 05836-L06321; (e) 274 bp 11980-L12803. C) HBB:c.*132C > A point mutation found in Family 3. Nucleotide change is indicated with an arrow. Nucleotides in capital letters represent transcribing sequence.

Family 2

β Thalassemia intermedia phenotype was observed in the 5-year-old proposita (II-1) with a HbF value remarkably increased (80.5%). By analyzing independent phenotypes of both parents we observed a classical β0 allele carrier phenotype in the father (I-1) and her mother (I-2).

By Sanger sequencing of HBB gene in the proband, we observed the mutation HBB: c.118C > T (p.Gln39*) (or β39C > T) inherited from her father. The second molecular defect identified in the index case, inherited by her mother, was a deletion of the 3’ end of the HBB gene, comprising the third exon and the 3’ UTR of HBB. This deletion comprises the loss of a segment between 0.6 and 10.6 Kb: 11p15.4 (5193650-5202711)_(5203314-5204229) (Figure 1B). Therefore the β39C > Tdel genotype explains the thalassemia intermedia phenotype. Both parents were simple heterozygotes, the father β39C > TA, and the mother βdelA.

Family 3

The propositus is a 28-year-old male patient with β-thal intermedia phenotype, elevated HbF (8.7%) as well, and an unusual increment of HbA2 (7.8%). His 7-year-old daughter presented a typical β0 thalassemia carrier phenotype, with considerably elevated RBC and increased HbA2 (6.3%). Moreover, his one-year-old son presented a mild anemia (10.7 g/dL) with elevated HbF (8.4%), with microcytosis and slightly increased HbA2 (3.6%).

The molecular analysis by Sanger sequencing of the HBB gene revealed the presence of two single nucleotide mutations in compound heterozygosity condition in the propositus: c.118C > T (p.Gln39*) (or β39C > T) and c.*132C > A (Figure 1C). The c.118C > T mutation was transmitted to his daughter (II-1) and the other mutation, c.*132C > A, to his son (II-2).

Discussion

Beta thalassemia is one of the most commonly studied genetic diseases. It is mainly attributed to single nucleotide mutations in the HBB gene, however, association with other globin gene mutations such as HBA2 and HBA1 triplication is often observed. In Mexican individuals, a previous report observed the presence of -α3.7 and αααanti3.7 in 16% and 28% respectively of β-thal carriers (Nava, et al., 2006). The pathophysiology of β-thal is related to the unbalanced ratio of α/β-globin chains caused by the reduced (β+), or absent (β0) β-globin synthesis and the relative excess of free α-globin chains. In this paper we report three Mexican families with beta thalassemia intermedia due to different molecular defects.

In the first family, we detected the presence of a single β0 allele (HBB:c.118C > T) in the proposita and two sisters, whose phenotype resembles thalassemia intermedia since they all have severe but non-transfusion dependent anemia and elevated HbF. In five members of the family (I-1, II-1, II-2, II-3 and II-4), we observed the presence of an α-globin genes duplication encompassing the regulatory HS-40 region. Their hematological data were consistent with previous reports of families carrying one β0-thal allele along with an α-cluster duplication (Harteveld et al., 2008; Ben-Salah et al., 2017; Clark et al., 2018; Theodoridou et al., 2018). It is known that co-inheritance of α deletions represents a benefit for β-thal patients; on the other hand, increased α-globin chains due to genes duplication in β-thal patients leads to a more severe phenotype (Mettananda et al., 2015; Saleh-Gohari et al., 2015; Shang and Xu 2017). Several studies demonstrate the common association of α-globin gene duplications and a single β-thal allele as a cause of β-thal intermedia (Origa et al., 2014). To date, there are ten genetic rearrangements that end in additional copies of one or both alpha-globin genes including the worldwide-distributed 3.7 kb and 4.2 kb triplications (Clark et al., 2018). The duplication reported in this study is larger than duplicated segments previously reported. Additional molecular and/or cytogenetic testing such as a Comparative Genome Hybridization could help to understand the origins and exact location of these genetic variants.

The second family presented also thalassemia intermedia phenotype, however, their molecular basis included two β globin gene mutations: the typical HBB.c:118C > T and a new uncharacterized deletion involving the 3’ end of HBB gene. This deletion causes the loss of the third exon, therefore may produce a short unstable mRNA that could undergo early degradation. This early degradation mechanism is typical for mutations inducing a premature termination codon in coding sequences (Grosso et al., 2008; Rawa et al., 2017). It is important to notice the unusual increased HbF in the mother, who is a simple heterozygote for this deletion. Aside the high HbF level she presents a classical β0 thal allele carrier phenotype. There is a large number of deletions in the β-cluster that are associated with elevated HbF, nevertheless, these deletions usually involve the complete loss of gamma, delta and/or beta genes (Andersson et al., 2007; Thein and Wood, 2009; Pissard et al., 2013). The particular deletion reported in this study causes the loss of third exon and the possible loss of the HBB 3’ regulatory region (DNase I hypersensitive site; LOC110006319; Gene ID: 110006319), which includes multiple GATA1 binding protein sequences (https://www.ncbi.nlm.nih.gov/gene/107133510). Here again, further research is required to determine the exact breakpoints.

Although it is known that the loss of the 3’ regulatory sequences in HBB does not alter its own expression, little is known about its relationship with adult HBG2 and HBG1 expression (Bender et al., 2006; Reading et al., 2016). Several deletions concerning the β-globin gene cluster have been reported (Mettananda and Higgs, 2018; Thein 2013). They are classified in three main groups: those that remove the LCR (Locus Controlling Region); others that remove partially or totally the β-cluster genes (∊γδβ0-thalassemia, γδβ0-thalassemia, δβ0-thalassemia); and deletions that involve partial or complete loss of the β-gene, such as, the Asian/Indian 619 bp deletion of HBB 3’ end, the ≈45 kb Filipino deletion that removes the entire β-gene, and the recently reported 5’ β-globin gene deletions of 538 bp and 1517 bp (Waye et al., 1994; Patrinos et al., 2004; Shooter et al., 2015; Waye et al., 2017;).

Concerning the third family, in this paper we report for the first time a single nucleotide mutation involving the last nucleotide of the β RNA transcript, a transversion C > A in the position c.*132. This mutation was observed in a 28-year-old male patient in compound heterozygosity with HBB: c.118C > T. Given the patient’s hematological data we infer the possible pathological effect of this mutation. Additional evidence was provided by his son data, who is a simple heterozygote for this allele and presents microcytic hypochromic features with elevated HbA2 typical of a beta-thalassemia trait (Table I). This mutation involves the last nucleotide of the HBB transcript, located nearly 20 bp upstream the poly-A signal (https://www.ncbi.nlm.nih.gov/gene/3043) and has a possible disrupting effect on transcription and RNA maturation processes. To our knowledge, there is a report of another transition in the same position (*132C > T) associated with c.92+1G > A in a patient with β-thal intermedia phenotype (Bilgen et al., 2013). Although the patient’s phenotype reveals a clear evidence of the pathological effect of this mutation, further transcription and mRNA analysis are required for establishing said effect. It has come to our interest the unusual elevated HbA2 in this family (I-1 and II-2). Usually, this particular feature is associated with β gene promoter deletions or single nucleotide mutations that involve CACCC, CCAAT or TATA elements (Thein 2018). In both of these patients, sequence analysis showed no mutations in HBB promoter.

HBG2:c.-211C > T polymorphism was observed in heterozygosity in three members of the first family with normal HbF (I-2, II-2 and II-5, Table 1), and two members of the second family with elevated HbF (I-2 and II-1, Table 1), therefore, the effect of this variant on the induction of γ-globin chains cannot be easily explained in these Mexican families.

Beta thalassemia intermedia is a widely variable disease, although the vast majority of mutations are associated to β globin gene, other genes can be involved. For this reason, it is important not to despise other genetic factors, such as other globin genes (α, γ or δ) or genetic variants located outside the globin gene clusters. Additional genomic approaches could clarify the etiology, as well as the clinical heterogeneity of this pathology.

Conclusions

We report for the first time three Mexican families with beta thalassemia intermedia due to different molecular defects. Likewise, we report a new single nucleotide mutation (HBB: c.*132C > A) involving the last nucleotide of the β-globin chain transcript; as well for the first time in Mexican population, two possible new DNA rearrangements, an α cluster duplication that includes both α genes, and a partial β gene deletion. HBB: c.118C > T mutation is the most frequent β-thal allele in Mexican population (Rizo-de la Torre et al., 2017), for this reason it is not surprising to find its association with other mutations as a main cause of β-thal intermedia. β-thal intermedia is supposed to be uncommon in our population, whereas β-thal carriers are rather frequent suggesting that this condition might be underdiagnosed therefore it is important to identify unusual or new variants that could lead to complex cases of hemoglobinopathies.

Acknowledgments

This work was supported by a studentship from Programa para el Desarrollo Profesional en Investigación Internacional de Estudiantes de Posgrado/Fondo de Investigación en Salud/Instituto Mexicano del Seguro Social (PRODESI/FIS/IMSS 2016) who was recieved by BC and BPN in Hôpital La Timone. MRC Holland provided charitably SALSA MLPA P140 HBA and P102 HBB probemixes 50 rxn, and SALSA MLPA EK1 reagent kit 100 rxn FAM.

Notes

Associate Editor: Luis F.Z. Batista

Conflict of interest

The authors declare no conflict of interest.

Authorship

RTLC performed the research, analyzed the data and wrote the paper, PDFJ designed the research study, contributed essential reagents, analyzed data and wrote the paper, ICB designed the research study, analyzed data, wrote the aper, RLVM performed the research, SLJY analyzed data, wrote the paper, SAFJ derived patients and collected clinical data, MTMT provided essential tools and wrote the paper, GK performed the research, BC designed the research study, contributed essential reagents and tools, BPN designed the research study, analyzed data, wrote the paper. All authors made substantial contributions to research design, or the acquisition, analysis or interpretation of data; drafted the paper and revised it critically; and approved the submitted version.

References

1 

    Andersson BA, Wering ME, Luo HY, Basran RK, Steinberg MH, Smith HP, Chui DH 2007. . Sickle cell disease due to compound heterozygosity for Hb S and a novel 7.7-kb beta-globin gene deletion. Eur J Haematol 78: , pp.82-85

2 

    Ben-Salah N, Bou-Fakhredin R, Mellouli F, Taher AT 2017. . Revisiting beta thalassemia intermedia: past, present, and future prospects. Hematology 22: , pp.607-616

3 

    Bender MA, Byron R, Ragoczy R, Telling A, Bulger M, Groudine MF 2006. . HS-62.5 and 3’HS1, and regions upstream of the LCR, are not required for β-globin transcription. Blood 108: , pp.1395-1401

4 

    Bilgen T, Clark OA, Ozturk Z, Akif-Yesilipek M, Keser I 2013. . Two novel mutations in the 3’ untranslated region of the beta-globin gene that are associated with the mild phenotype of beta thalassemia. Int J Lab Hem 35: , pp.26-30

5 

    Clark B, Shooter C, Smith F, Brawand D, Steedman L, Oakley M, Rushton P, Rooks H, Wang X, Drousiotou A, 2018. . Beta thalassemia intermedia due to co-inheritance of three unique alpha globin cluster duplications characterised by next generation sequencing analysis. Br J Haematol 180: , pp.160-164

6 

    Grosso M, Palumbo I, Morelli E, Puzone S, Sessa R, Izzo P 2008. . Defective mRNA levels are responsible for a beta-thalassemia phenotype associated with Hb Federico II, a novel hemoglobin variant [beta-106 (G8) Leu- > Val]. Haematologica 93: , pp.1096-1098

7 

    Harteveld CL, Refaldi C, Cassinerio E, Cappellini MD, Giordano PC 2008. . Segmental duplications involving the α-globin gene cluster are causing β-thalassemia intermedia phenotypes in β-thalassemia heterozygous patients. Blood Cells Mol Dis 40: , pp.312-316

8 

    Huisman THJ, Jonxis JHP 1977. The hemoglobinopathies techniques of identification Marcel Dekker Inc.New York , pp.464

9 

    Liu YT, Old JM, Miles K, Fisher CA, Weatherall DJ, Clegg JB 2000. . Rapid detection of alpha-thalassemias deletions and alpha-globin gene triplication by multiples polymerase chain reactions. Br J Haematol 108: , pp.295-299

10 

    Mettananda S, Gibbons RJ, Higgs DR 2015. . α-Globin as a molecular target in the treatment of β-thalassemia. Blood 125: , pp.3694-3701

11 

    Mettananda S, Higgs DR 2018. . Molecular basis and genetic modifiers of thalassemia. Hematol Oncol Clin North Am 32: , pp.177-191

12 

    Miller SA, Dykes DD, Polesky HF 1988. . A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16: , pp.1215

13 

    Nava MP, Ibarra B, Magaña MT, Chávez ML, Perea FJ 2006. . Prevalence of -α3.7 and αααanti3.7 alleles in sickle cell trait and β-thalassemia patients in Mexico. Blood Cells Mol and Dis 36: , pp.255-258

14 

    Ngo DA, Steinberg MH 2015. . Genomic approaches to identifying targets for treating β hemoglobinopathies. BMC Med Genomics 8: , pp.44

15 

    Old JM, Varawalla NY, Weatherall DJ 1990. . Rapid detection and prenatal diagnosis of β-thalassemia: studies in Indian and Cyprot population in the UK. Lancet 336: , pp.834-837

16 

    Origa R, Sollaino MC, Borgna-Pignatti C, Piga A, Feliu-Torres A, Masile V, Galanello R. 2014. . α-globin gene quadruplication and heterozygous β-thalassemia: a not so rare cause of thalassemia intermedia. Acta Haematol 131: , pp.162-164

17 

    Patrinos GP, Giardine B, Riemer C, Miller W, Chui DHK, Anagnou NP, Wajcman H, Hardison RC 2004. . Improvements in the HbVar database of human hemoglobin variants and thalassemia mutations for population and sequence variation studies. Nucl Acids Res 32: , pp.D537-541

18 

    Pissard S, Raclin V, Lacan P, Garcia C, Aguilar-Martinez P, Francina A, Joly P 2013. . Characterization of three new deletions in the β-globin gene cluster during a screening survey in two French urban areas. Clin Chim Acta 415: , pp.35-40

19 

    Rawa K, Szczesny RJ, Owczarek EP, Adamowicz-Salach A, Klukowska A, Demkow U, Plochocka D, Szczesny P, Gora M, Dziembowski A, 2017. . Two novel C-terminal frameshift mutations in the β-globin gene lead to rapid mRNA decay. BMC Medical Genetics 18: , pp.65

20 

    Reading NS, Shooter C, Song J, Miller R, Agarwal A, Lanikova L, Clark B, Thein SL, Divoky V, Prchal JT 2016. . Loss of major DNase I hypersensitive sites in duplicated β-globin gene cluster incompletely silences HBB gene expression. Hum Mutat 37: , pp.1153-1156

21 

    Rizo-delaTorre LC, Ibarra B, Sánchez-López JY, Magaña-Torres MT, Rentería-López VM, Perea-Díaz FJ 2017. . Three novel HBB mutations, c.-140C > G (-90 C > G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T > G (IVS2:2 T > G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients. Int J LabHem 39: , pp.539-545

22 

    Saleh-Gohari N, Khademi-Bami M, Nikibakht R, Karimi-Maleh H 2015. . Effects of α-thalassemia mutations on the haematological parameters of β thalassemia carriers. J Clin Pathol 68: , pp.562-566

23 

    Shang X, Xu X 2017. . Update in the genetics of thalassemia: What clinicians need to know. Best Pract Res Clin Obstet Gynaecol 39: , pp.3-15

24 

    Shooter C., Rooks H, Thein SL, Clark B 2015. . Next generation sequencing identifies a novel rearrangement in the HBB cluster permitting to-the-base characterization. Hum Mutat 36: , pp.142-150

25 

    Sripichai O, Fucharoen S. 2016. . Fetal hemoglobin regulation in β-thalassemia: heterogenity, modifiers and therapeutic approaches. Expert Rev Hematol 9: , pp.1129-1137

26 

    Thein SL 2013. . The molecular basis of β-thalassemia. Cold Spring Harb Perspect Med 3: , pp.a011700

27 

    Thein SL 2018. . Molecular basis of β thalassemia and potential therapeutic targets. Blood Cells Mol Dis 70: , pp.54-65

28 

    Thein SL, Wood WG 2009. The molecular basis of β thalassemia, δβ thalassemia, and hereditary persistence of fetal hemoglobinSteinberg MH, Forget BG, Higgs DR, Weatherall DJDisorders of the hemoglobin: genetics, pathophysiology, and clinical management Cambridge University PressNew York , pp.323-356

29 

    Theodoridou S, Vyzantiadis TA, Vlachaki E 2018. . Compound heterozygosity for silent cap +1570 (T > C) (HBB:c*96T > C), codon 39 (C > T) (HBB:c.118C > T) and the presence of αααanti-3.7/αα in Greece. A case presentation. Hemoglobin 12: , pp.1-2

30 

    Vives-Corrons JL, Pujades MA, Miguel-García A, Miguel-Sosa A, Cambiazzo S 1992. . Rapid detection of Spanish (δβ)0-thalassemia deletion by polymerase chain reaction. Blood 80: , pp.1582-1585

31 

    Waye JS, Eng B, Hunt JA, Chui DH 1994. . Filipino beta-thalassemia due to a large deletion: identification of the deletion end points and polymerase chain reaction (PCR)-based diagnosis. Hum Genet 5: , pp.30-532

32 

    Waye JS, Hanna M, Hohenadel BA, Nakamura L, Walker L, Eng B 2017. . Characterization of Two Novel Deletions Involving the 5’ Region of the β-Globin Gene. Hemoglobin 41: , pp.239-242

33 

    Zhong L, Gan X, Xu L, Liang C, Xie Y, Lin W, Chen P, Liu M 2018. . The phenomena of balance defect between α-globin gene and of β-globin gene. BMC Med Genet 19: , pp.145
https://www.researchpad.co/tools/openurl?pubtype=article&doi=10.1590/1678-4685-GMB-2019-0032&title=Three Mexican Families with β thalassemia intermedia with different molecular basis&author=Lourdes del Carmen Rizo de la Torre,Francisco Javier Perea Díaz,Bertha Ibarra Cortés,Víctor Manuel Rentería López,Josefina Yoaly Sánchez López,Francisco Javier Sánchez Anzaldo,María Teresa Magaña Torres,Katia Gonnet,Catherine Badens,Nathalie Bonello-Palot,&keyword=Thalassemia intermedia,Mexican population,β globin gene,new mutations,alpha-globin gene duplication,&subject=Human and Medical Genetics,