Members of the Schlafen (Slfn) family are specific to mammals. Schlafen family members in mice (Slfn1, 2, 3, 4, 5, 8, 9, 10 and 14) only partially overlap with those in humans (SLFN5, 11, 12, 13 and 14 ) [1]. While mouse Slfns have been reported to function in immune response and lymphocyte development, expression and function of human SLFNs in lymphocytes have not been studied [2–4].
SLFN11, a putative DNA/RNA helicase, has recently been analyzed for its functions in DNA damage response [5, 6], restriction factor against replication stress [7, 8], RNA cleavage activity [9], and defense against viral infection [10–12]. As for its role in DNA damage response, independent studies have shown that SLFN11 augments the sensitivity of cancer cells to a wide range of DNA-damaging agents including platinum-derivatives, topoisomerase inhibitors, PARP inhibitors and replication inhibitors [4–6, 13–16]. Clinical studies indicate the potential value of SLFN11 as a predictive biomarker for the response to these drugs in lung and breast cancers [17, 18]. Mechanistically, SLFN11 binds to chromatin at stressed replication forks that are generated after DNA damage where it selectively blocks fork progression, and consequently induces cell death [7]. Hence, SLFN11 has come forward for its significant role as executor of cells harboring genotoxic stress.
B-cells undergo gene editing at variable regions of the immunoglobulin gene loci during the development and maturation. During this process, B-cells are physiologically exposed to genotoxic stress caused by somatic hypermutations and class-switch recombination [19, 20]. Such genotoxic stress is introduced particularly to centroblasts and centrocytes in germinal centers (GCs) of lymph nodes by activation-induced cytidine deaminase (AID) to generate different antibodies [21]. AID further induces DNA deamination at non-targeted genes [22]. Thus, germinal center B-cells (GCBs: centroblasts and centrocytes) are presumably exposed to genotoxic stress. Here, we hypothesized that the expression of SLFN11 needs to be controlled during B-cell development to avoid SLFN11-dependent cell death in cells undergoing genomic rearrangements.
The expression level of SLFN11 widely varies among cell types and tissues [6, 23]. Its expression has been shown to be largely regulated by epigenetic modifications of DNA and/or histones at its promoters, whereas gene copy number alterations and deleterious mutations of SLFN11 have been rarely reported [24–26]. Hence, SLFN11 expression can be activated by epigenetic modifiers such as inhibitors for DNA methyltransferases, EZH2 a histone methyltransferase, and histone deacetylases [24–26].
The aim of this study was to clarify the expression pattern of SLFN11 in B-cells at different stages of development and differentiation and the potential roles played by SLFN11 in B-cells. We show that SLFN11 expression is epigenetically driven during B-cell development, and is typically suppressed in GCBs. Moreover, we show that epigenetic activation of SLFN11 in lymphomas of GCB origin enhances their susceptibility to the clinical DNA-damaging agent cytosine arabinoside, which targets DNA replication.
Microarray gene expression data derived from flow-sorted B-cell subsets in human bone marrow and tonsil were obtained from NCBI’s Gene Expression Omnibus database (GSE68878 and GSE69033) [27]. The exon array data were RMA normalized using R/BioC and a custom Chip Description File (CDF) [28, 29].
RNA-sequence gene expression data derived from 1001 diffuse large B-cell lymphoma (DLBCL) samples and the core set of 624 DLBCL samples was obtained from EGA (dataset id: EGA00001003600). Gene expression was measured using terms of fragments per kilobase of exon per million fragments mapped and normalized using the Cufflinks package, version 2.2.1 [30]. Quantile normalization was performed, and the data were log2 normalized.
Gene expression data, RNA-seq data, drug activity data were obtained from Genomics of Drug Sensitivity in Cancer (GDSC: https://www.cancerrxgene.org) and the Cancer Cell Line Encyclopedia (CCLE: https://portals.broadinstitute.org/ccle) using CellMinerCDB (https://discover.nci.nih.gov/cellminercdb/) [31].
For immunohistochemical (IHC) staining analysis, we used formalin-fixed paraffin-embedded (FFPE) lymphatic tissue samples from eight cancer patients. All samples were obtained from the archives of the National Hospital Organization Kure Medical Center and Chugoku Cancer Center with the informed consent for the patients. This study was approved by the Ethics Committee of Kure Medical Center and Chugoku Cancer Center, Kure, Japan (No. 2019–36) and conformed to the ethical guidelines of the Declaration of Helsinki.
The antibodies used for IHC were as follows; mouse monoclonal anti-SLFN11 antibody (D-2, #sc-515071, Santa Cruz, 1:50 dilution), mouse monoclonal anti-CD3 antibody (F7.2.38, #20019562, DAKO, 1:400 dilution), mouse monoclonal anti-CD20cy antibody (L26, #00083951, DAKO, 1:800 dilution), mouse monoclonal anti-CD138 antibody (MI15, #00046047, DAKO, 1:100 dilution) and rabbit monoclonal anti-CD38 (EPR4106, ab108403, Abcam, 1:1000 dilution).
Formalin-fixed paraffin-embedded tissue sections (4 μm) were deparaffinized with fresh xylene for 5 min 4 times and were rehydrated with 100% ethanol, 90% ethanol, and 80% ethanol for 5 min each. Antigen retrieval was performed by pressure cooker in EnVision FLEX TARGET RETRIEVAL SOLUTION HIGH PH (50×) (DAKO) for 5 min. Endogenous peroxidase activity was blocked by incubating the sections for 10 min. For SLFN11 staining, the sections were incubated with mouse monoclonal anti-SLFN11 antibody (1:50 dilution in REAL Antibody Diluent (DAKO)) at room temperature for one hour. The sections were incubated with the second antibody (REAL EnVision Detection Reagent Peroxidase Mouse, 100 μL) at room temperature for 60 hours. The sections were incubated with DAB ENHANCER (DAKO) for 10 min. For CD markers, after incubation with the mouse monoclonal antibodies, the sections were incubated with Affinity Pure Rabbit Anti-Mouse IgG (H+L) at room temperature for one hour. The sections were treated with Stayright Purple HRP Staining substrate (#45900, AAT Bioquest) at room temperature for 10 min. The sections were counterstained with Mayer’s hematoxylin for 1 min. For scoring SLFN11-positive population (%), we manually counted the number of SLFN11-positive cells in each CD marker-positive cells for more than 100 cells and from 3 different samples.
The following cell lines used in this experiment were described previously [32–34]; a germinal center B-cell-like (GCB)-DLBCL line SU-DHL6; a Burkitt lymphoma (BL) line Daudi; follicular lymphoma (FL) lines FL18, FL218 and FL318. These cell lines were tested negative for mycoplasma (TaKaRa PCR Mycoplasma Detection Set; 6601), maintained in RPMI1640 (Nacalai Tesque, Kyoto, Japan) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin/L-glutamine and cultured at 37°C in a humidified incubator in the presence of 5% CO2. An EZH2 inhibitor tazemetostat (EPZ6438) was purchased from Apexbio (Boston, MA, USA). A histone deacetylase (HDAC) inhibitor panobinostat (LBH589) was purchased from Selleck Chemicals (Houston, TX, USA). The cells were seeded at 0.2–1.0 × 106 cells in 2 ml of medium per well in 12 well plates and treated with 5 μM tazemetostat for 4 days or 10 nM panobinostat for 16 hours before being collected for RNA extraction and western blotting. Dimethyl sulfoxide (DMSO) was used as a vehicle control.
Total RNA was extracted using RNeasy Mini kit (Qiagen, Hilden, Germany) and complementary DNA (cDNA) was synthesized using SuperScript III First-Star and Synthesis system (Life Technologies, Carlsbad, CA, USA). Quantitative RT-PCR was performed using TB Green Premix Ex Taq II (Takara). Relative gene expression was normalized to ACTB expression. The sequence information of primers used for RT-PCR is available in S1 Table.
To prepare whole cell lysates, cells were lysed with RIPA lysis buffer system (Santacruz Biotechnology, TX, USA). Samples were mixed with tris-glycine SDS sample buffer (Nacalai Tesque) and loaded onto tris-glycine gels (BioRad). Blotted membranes were blocked with 4% bovine serum albumin (BSA) (Sigma-Aldrich. A9418) in phosphate-buffered saline (PBS) with 0.1% tween-20 (PBST). The primary antibody was diluted in 5% BSA/PBST by 1:3000 for SLFN11, and 1:10000 for Actin and acetyl-histone H3 (Lys9) (H3K9ac). The HRP-conjugated secondary antibody for mouse or rabbit (Cell Signaling, 7074S for rabbit and 7076S for mouse) was diluted in 4% BSA/PBST by 1:10000. After the membrane was soaked in ECL solution (BioRad), the blot signal was detected with luminescent image analyzer (LAS4000, GE healthcare). The mouse monoclonal anti-SLFN11 antibody (sc-515071X, 2 mg/ml, mouse monoclonal IgG against amino acids 154–203 mapping within an internal region of SLFN11 of human origin, Santacruz), the rabbit monoclonal anti-Actin antibody (12748S, rabbit monoclonal antibody to a synthetic peptide corresponding to residues near the carboxy terminus of human β-actin protein, Cell Signaling) and the rabbit monoclonal anti-acetyl-histone H3 (Lys9) (9649S, rabbit monoclonal antibody to a synthetic peptide corresponding to the amino terminus of histone H3 in which Lys9 is acetylated, Cell Signaling) were used.
Cell viability experiments by flow cytometry in Fig 5B and 5C were performed as follows: 5 × 104 cells/mL viable cells were pretreated with 100 or 500 nM tazemetostat for 4 days, and 2–5 × 105 cells/mL viable cells were pretreated with 5 or 10 nM panobinostat for 16 hours; 2–32 μM AraC was added to the cells for additional 24-hour incubation followed by evaluation of cell viability using Flow cytometry. Flow cytometry was performed using FACSlyrics (BD Biosciences, San Jose, CA, USA). Propidium Iodide Solution (Biolegend; 421301) was used for the evaluation of cell viability. Data were analyzed using FlowJo software (version 10.1; Tree Star Inc, San Carlos, CA, USA). Viability (%) of treated cells was defined as treated cells/untreated cells × 100. Combination index (CI) values were assessed using the CompuSyn Software (Combosyn Inc., Paramus, NJ) [35, 36].
For viability assay in Fig 5E, ten thousand SU-DHL6 cells were seeded in 96-well white plates (Perkin Elmer Life Sciences, 6007680) in 100 μL of medium per well. Cellular viability was determined using the ATPlite 1-step kits (PerkinElmer). Luminescence was measured by TECAN infinite M200. The ATP level in untreated cells was defined as 100%. Viability (%) of treated cells was defined as ATP level of treated cells/ATP level of untreated cells × 100.
The doxycycline-inducible expression vector (pPCTetOn) (S1 Fig) was first made by insertion of Xho I-digested 5’- and 3’-terminal inverted repeats (IRs) cassette sequences of the piggyBac system [37] amplified by PCR using two oligos:
5’-CCGCTCGAGTTAACCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAATCATGCGTAAAATTGACGCATGTTCGAAATGCATGG and 5’-CCGCTCGAGTTAACCCTAGAAAGATAGTCTGCGTAAAATTGACGCATGCGAATTCGGTACCATGCATTTCGAACATGCG into the Sal I-digested pcDNA3 vector [38] to create the pcDNA-IRs. The CAG promoter digested with Mph1103 I and Acc65 I from pCAG-BSD vector (WAKO) was cloned into pcDNA-IRs with Mph1103 I and Acc65 I to create pPC. The 3xFL-IRES-PuroR-HSV TK poly (A) signal fragment was PCR amplified from pMX-3xFL-IP [39] using primers 5’-
CGGAATTCATGGGCGTTGCCATGCCAGGTGCCGAAGATGATGTGGTGTAACAATTCATGGACTACAAAGACCATGACGG and 5’-
ACATGCATGCGAACAAACGACCCAACACCGTGCGTTTTATTCTGTCTTTTTATTGCCGGTCGACTCAGGCACCGGGCTTGCGGG. The PCR product was cloned into pPC with EcoR I and Pae I to create pPC-IP. The Trans Activation Responsive region (TAR)- TransAcTivator (Tat) cassette was PCR amplified from pHEK293 Ultra Expression Vector (TaKaRa). TAR was amplified using primers 5’-CCTCACTAAAGGTGTACAGTACTTCAAGAACTGCTGATATC and 5’-
CTAGGATCTACTGGCTCCATGAGGCTTAAGCAGTGGGTTC, and Tat-P2A was amplified using primer 5’- GAACCCACTGCTTAAGCCTCATGGAGCCAGTAGATCCTAG and 5’-
GGGGTACCAGGTCCAGGGTTCTCCTCCACGTCTCCAGCCTGCTTCAGCAGGCTGAAGTTAGTAGCTCCGCTTCCTTCCTTCGGGCCTGTCGGGTC, respectively. These PCR products were mixed and used as a template to amplified TAR-Tat-P2A using primer 5’-
CCTCACTAAAGGTGTACAGTACTTCAAGAACTGCTGATATC and 5’-
GGGGTACCAGGTCCAGGGTTCTCCTCCACGTCTCCAGCCTGCTTCAGCAGGCTGAAGTTAGTAGCTCCGCTTCCTTCCTTCGGGCCTGTCGGGTC. A digested fragment with Bsp1407 I and Acc65 I from TAR-Tat-P2A was cloned into pPC-IP with Acc65 I to create pPCTA-IP. HA-TetOn3G was PCR amplified from pRetroX-TetOne vector (Clontech) using primer 5’-
GGGGTACCATGTACCCATACGATGTTCCAGATTACGCTTCAAGACTGGACAAGAGCAAA
G and 5’-GGCAACGCCCATCAATTGTTACCCGGGGAGCATGTCAAG. HA-TetOn3G digested with Acc65 I and Mun I was cloned into pPCTA-IP digested with Acc65 I and EcoR I to create pPCTA-TetOn3G-IP. The TRE3GS promoter was PCR amplified from pRetroX-TetOne vector using primers 5’-ACATGCATGCATGCATGTGGAATTATCACCTCGAG and 5’-
TATTGCCGCAATTGTTACACCACATCATCTTCGGCACCTGGCATGGCAACGCCGAATTCACGCGTGCGGCCGCTGGATCCTTTACGAGGGTAGGAAGTGG, and the PCR product was sequentially amplified by using primers 5’-
ACATGCATGCATGCATGTGGAATTATCACCTCGAG and 5’-
AATTGACGCATGTTCGAAGAACAAACGACCCAACACCGTGCGTTTTATTCTGTCTTTTTATTGCCGCAATTGTTACAC. The second PCR product, TRE3GS-MCS-PA tag-HSV TK poly(A) signal fragment was cloned into pPCTA-TetOn3G-IP with Mph1103 I and Bsp119 I to create pPCTetOn. Full length of SLFN11 cDNA was amplified using primers 5’-
CGTAAAGGATCCAGCATGGAGGCAAATCAGTGCC and 5’-
CGAATTCACGCGTGCCTAATGGCCACCCCACGGAA, and integrated into NotI site of the pPCTetOn vector (pPCTetON-SLFN11) using Thermo GeneArt Seamless Cloning and Assembly Enzyme Mix (A14606). The products at each step were validated by sequencing.
The expression vector containing hyperactive PB transposase cDNA under CAG promoter (pCAG2-hyPB (S1 Fig)) was first made by replacement BSD in pCAG-BSD vector with AmpR to create pCAG2. The hyPB was PCR amplified from the pCMV-hyPBase vector (kindly provided by Dr. Yusa [40]) and cloned into pCAG2. Further plasmid information can be requested to the corresponding author (J.M.).
The doxycycline-inducible SLFN11 expression vector (pPCTetOn-SLFN11) and the modified expression vector of hyperactive PB transposase under CAG promoter (pCAG2-hyPB) [37] was co-transfected into SU-DHL6 cells by electroporation. One week after the transfection, cells were incubated in puromycin (0.2 μg/ml) containing medium for another 2 weeks, and surviving cells were used for the assays.
Cells were deposited onto slide glasses (Superfrost Plus Microscope Slides precleaned, Fisher Scientific, 12-550-15) by cytospin. The deposited cells were fixed with 4% paraformaldehyde for 10 min followed by permeabilization with 0.1% Triton X-100/PBS for 15 min. The cells were incubated with 5% BSA/PBST for 30 min (blocking step). After the blocking step, the cells were incubated overnight with a primary antibody of SLFN11 (1:300 dilution) in 4% BSA/PBST in a moisture chamber at 4°C. After washing with PBST, the cells were incubated with a proper second antibody (Alexa 488 goat anti-mouse IgG Molecular Probes cat# A11001, 1:1000 dilution) in 4% BSA/PBST for 2 hours. After washing with PBST, the cells were mounted with Vectashield with DAPI (VECTOR, H-1200). Images were captured with a Zeiss LSM 900 confocal microscope.
To understand how SLFN11 expression is regulated during B-cell development, we mined publicly available microarray gene expression data of primary B-cells derived from healthy human bone marrow and tonsil at different developmental stages [27]. We found that, among transcriptional regulators, the expression of SLFN11 was most positively correlated with the expression of XBP1, a B-cell terminal differentiation factor, while it was most negatively correlated with PAX5 , a master regulator of B-cell development (Fig 1A left, S2 Table) [41]. Stage-wise plotting of the data revealed that SLFN11 expression was almost reverse of PAX5 expression throughout the developmental stages (Fig 1A right). The data arranged from premature to differentiated B-cells showed that SLFN11 expression was relatively low in immature B-cells, naïve B-cells, and GCBs (centroblasts and centrocytes) (Fig 1B). The pattern of SLFN11 expression was almost parallel to the expression of PRDM1 and XBP1 , both of which are key transcription factors for B-cell terminal differentiation (Fig 1B) [21, 42]. By contrast, other SLFN family members (SLFN5, 12, 13 and 14) neither showed a marked correlation with PAX5, PRDM1 nor XBP1 (S2A and S2B Fig). Thus, among SLFNs, SLFN11 uniquely showed parallel expression profile compared to PRDM1 and XBP1 and reverse expression profile with respect to PAX5 across B-cell development.
Next, we mined the database Cancer Cell Line Encyclopedia (CCLE) [5] to examine SLFN11 expression levels across different histologic subtypes of B-cell-derived cancer cell lines: B-ALL (B-cell acute lymphoblastic leukemia), GCB-DLBCL (germinal center B-cell like-diffuse large B-cell lymphoma), BL (Burkitt lymphoma), B-CLL (B-cell chronic lymphocytic leukemia), ABC-DLBCL (activated B-cell like-diffuse large B-cell lymphoma) and PCM (plasma cell myeloma). According to the origins of B-cells, the subtypes can be arranged from premature to differentiated types, and can be linked to their normal counterparts (Fig 1B below). We found that GCB-DLBCL had relatively lower expression levels of SLFN11 while B-ALL and ABC-DLBCL expressed highest levels of SLFN11 (Fig 1C). BL and PCM showed a broad SLFN11 expression pattern. Thus, SLFN11 expression levels in B-ALL, GCB-DLBCL and ABC-DLBCL appear to reflect their normal counterparts. Overall, SLFN11 expression level is differentially regulated during B-cell development.
As we found that SLFN11 is low in GCBs (centroblasts and centrocytes) and high in plasmablasts (Fig 1B), we attempted to validate the findings using dual immunohistochemical staining (IHC). Co-expression of SLFN11 and B-cell specific markers at each developmental stage was examined with multiple human normal lymphatic tissues. Fig 2A (left) shows a typical localization of B-cells at each stage of differentiation in normal lymphatic tissues. To identify the stages of B-cells, we used CD20 as a marker for premature B-cells before differentiation to plasmablasts, CD38 for plasmablasts and plasmacytes, and CD138 for plasmacytes (Fig 2A right) [43]. In GCs of tonsil tissue, CD20-positive cells were mostly negative for SLFN11, while the majority of CD38-positive cells were positive for SLFN11 (Fig 2B). CD138-positive cells were rarely found in the GCs (Fig 2B). When we focused on the outside of GCs, the mantle zone was rich of CD20-positive cells that were mostly negative for SLFN11 (Fig 2C). The cortex zone was rich of CD38-positive or CD138-positive cells that were mostly positive for SLFN11 (Fig 2C). We also performed dual IHC with two samples of spleen (S3A and S3B Fig), another tonsil sample (S4A Fig) and two samples of lymph node (S4B and S5A Figs). Similar results to Fig 2B and 2C were obtained. Additionally, we stained CD3, a general T-cell maker, and found that CD3-positive cells were mostly negative for SLFN11 (Fig 2B–2D, S3–S5 Figs). Statistically, CD38-positive or CD138-positive cells expressed SLFN11 significantly higher than CD20-positive cells (Fig 2D), which is consistent with our findings from the database analyses (Fig 1B). Collectively, our analyses reveal that SLFN11 expression changes along with B-cell development and is notably suppressed in GCBs.
DLBCL (diffuse large B-cell lymphoma) is classified into two main subtypes, GCB-DLBCL and ABC-DLBCL. In the clinic, high expression of BCL6, a transcriptional repressor required for GC formation, is used as a diagnosis indicator for GCB-DLBCL [44]. Because we have found the differential expression of SLFN11 between GCB-DLBCL and ABC-DLBCL, we compared ABC-DLBCL and GCB-DLBCL with respect to SLFN11 and BCL6 expression. The correlation analysis of SLFN11 and BCL6 clearly separated ABC-DLBCL from GCB-DLBCL (Fig 3A).
We then investigated the expression of SLFN11 in DLBCL tissues from patients using the database established by Reddy et al. [45]. In addition to BCL6 , a set of genes has been reported to be distinctively expressed in the DLBCL subgroups and used to classify DLBCL [45, 46]. The set of genes includes eleven ABC-DLBCL-associated genes and eight GCB-DLBCL-associated genes (Fig 3B). Correlation analyses revealed that the expression of SLFN11 is significantly negatively correlated to five GCB-DLBCL-associated genes (MME, LRMP, MYBL1, ITPKB, BCL6), whereas it is significantly positively correlated to six ABC-DLBCL-associated genes (IRF4, PIMI, CCND2, ENTPD1, PTPN1, ETV6 ) (Fig 3B and 3C). These results consolidate the finding of differential expression of SLFN11 between ABC-DLBCL and GCB-DLBCL in clinical samples.
As epigenetic modifications are known to regulate GCB-specific genes [47–49], we hypothesized that the expression of SLFN11 might also be epigenetically downregulated in GCBs. We first examined the correlation between SLFN11 expression level and DNA methylation level of the SLFN11 promoter in the dataset used in Fig 1C (Fig 4A). DNA methylation data were available in 63 out of the 79 cell lines. Overall, we found a significantly negative correlation between SLFN11 expression and promoter DNA methylation levels (Fig 4A).
Notably, eight of the nine GCB-DLBCL cell lines had low SLFN11 expression without promoter DNA methylation. This led us to focus on histone modification as regulator of SLFN11 expression. We tested two epigenetic modifiers, the EZH2 inhibitor tazemetostat (EPZ6438) and the histone deacetylase (HDAC) inhibitor panobinostat (LBH589), both of which have been reported to upregulate the expression of genes that are specifically suppressed in GCBs [50, 51].
We evaluated the effect of these epigenetic modifiers on the expression levels of selected GCB- and ABC-DLBCL-associated genes across the six GCB-derived lymphomas: GCB-DLBCL cell line SU-DHL6, BL cell line Daudi, and follicular lymphoma cell lines FL18, FL218 and FL318. By quantitative RT-PCR, we found that both of the epigenetic modifiers upregulated the ABC-DLBCL-associated genes, whereas they downregulated the GCB-DLBCL-associated genes in the GCB-derived lymphomas (Fig 4B). Under the same conditions, SLFN11 gene expression was upregulated by both of the epigenetic modifiers across all the cell lines examined (Fig 4B). The activation of SLFN11 expression was validated at the protein level in FL18 and FL318 cells after the treatment with either epigenetic modifier (Fig 4C). We failed to detect SLFN11 at protein levels in the other cell lines possibly because the expression levels were too low to be detected. Based on these results, we conclude that SLFN11 expression is suppressed epigenetically by histone post-translational modifications concomitantly with ABC-DLBCL-associated genes in GCB-derived lymphomas.
Cytosine arabinoside (AraC, cytarabine), a replication inhibitor, is one of the therapeutic options for patients with B-cell-derived cancers. Data of drug activity (inhibitory concentration 50%: IC50) and RNA-seq data of ~1000 human cancer cell lines are available from the Genomics of Drug Sensitivity in Cancer (GDSC; https://www.cancerrxgene.org) and the NCI CellMiner databases (https://discover.nci.nih.gov/cellminercdb). Drug activity data of AraC and SLFN11 expression data were accessible in 39 cell lines out of the 79 B-cell-derived cancer cell lines used in Fig 1C. Correlation analysis reveals that SLFN11 expression is significantly correlated with the activity of AraC (Fig 5A left), indicating the potential utility of SLFN11 expression as predictor of drug activity for AraC in B-cell-derived cancers. In addition to AraC, the activity of camptothecin (CPT), a topoisomerase inhibitor was also found correlated to SLFN11 expression in 31 B-cell-derived cancer cell lines available in the GDSC database (Fig 5A right).
Next, we examined the potential synergistic effect of AraC on SU-DHL6 cells with or without pretreatment of the EZH2 inhibitor (tazemetostat) or the HDAC inhibitor (panobinostat) to induce SLFN11 expression. We found that the pretreatment with these epigenetic modifiers enhanced cell susceptibility to AraC in SU-DHL6 cells (Fig 5B and 5C left). Combination index (CI) value was used to evaluate synergistic effects of the combination, and revealed that concurrent treatment of AraC with tazemetostat or panobinostat exhibited synergistic effects at various doses (Fig 5B and 5C right).
To test whether SLFN11 enhances the susceptibility to DNA damaging agents, we generated doxycycline-inducible SLFN11-overexpressing SU-DHL6 (SU-DHL6 tetON SLFN11) cells. The overexpression of SLFN11 was confirmed by western blot and immunofluorescence (Fig 5D). SLFN11 overexpression made SU-DHL6 cells more susceptible to AraC and CPT (Fig 5E). These results indicate that the induction of SLFN11 can improve the therapeutic response to AraC in GCB-derived lymphomas.
In this study, we show that SLFN11 expression is differentially regulated during B-cell development. We find that SLFN11 is typically suppressed in GCBs (centroblasts and centrocytes) and GCB-derived lymphomas. The suppression is partly achieved epigenetically, and is reversible with the EZH2 inhibitor tazemetostat or the HDAC inhibitor panobinostat, which increase the cytocidal function of AraC. These results suggest that these combinations could be applied to the treatment of GCB-derived lymphomas having low SLFN11.
Physiological reasons why SLFN11 needs to be suppressed in GCBs are not biologically examined in this study. However, in GCBs, activation-induced cytidine deaminase (AID) is specifically highly expressed to introduce somatic hypermutations in variable regions of the immunoglobulin genes, while AID can also induce DNA damage at non-target genes by generating apurinic sites [52]. Furthermore, GCBs proliferate very rapidly [50], which can result in replication-dependent DNA damage [53]. Hence, GCBs are at high risk of eliciting a DNA damage response due to AID expression and rapid proliferation. Because SLFN11 exclusively executes replicating cells carrying genotoxic stress [7], we speculate that SLFN11 needs to be downregulated in GCBs to avoid SLFN11-dependent cell death in response to physiological genomic rearrangements in GCBs.
We then questioned which gene(s) are associated with SLFN11 expression in GCBs. We found that almost perfect inverse correlation between SLFN11 expression and PAX5 , a B-cell lineage-specific repressor (Fig 1A and 1B). By mining a public database of chromatin immunoprecipitation-sequencing for PAX5 [54], we found a potential PAX5 binding site (GCGTGAC) in the promoter region of SLFN11, suggesting that PAX5 may be one of the repressors of SLFN11 in B-cells. This possibility is also supported by the fact that SLFN11 expression is parallel to the expression of PRDM1 and XBP1 , which are the targets of PAX5 (Fig 1B).
Epigenetic regulation of SLFN11 has been reported in other malignancies. In small cell lung cancer cells, SLFN11 expression is silenced by marked deposition of H3K27me3, leading to drug resistance, and is reactivated by inhibition of EZH2 a methyltransferase for H3K27 [24]. The EZH2 inhibitor, tazemetostat has recently been approved by the FDA for the treatment of follicular lymphoma and its efficacy for DLBCL is being studied [55]. In leukemia K562 and fibrosarcoma HT1080 cell lines, both of which have a very low basal SLFN11 expression, HDAC inhibitors (romidepsin and entinostat) increase SLFN11 expression and enhance sensitivity to DNA-damaging agents in SLFN11-dependent manner [26]. Our data consolidate these findings with GCB-derived lymphoma cell lines and provide a rationale to treat B-cell lymphoma with low SLFN11 expression by combining tazemetostat with AraC. Moreover, this is the first report showing that SLFN11 can be physiologically regulated through histone modifications during normal developmental process.
As SLFN11 is a promising target to sensitize tumor cells to cytotoxic chemotherapy, regulatory factors of SLFN11 expression are also favorable targets for cancer treatment [56]. Our findings of dynamic regulation of SLFN11 during B-cell development will provide a basis to further investigate potential regulatory factors of SLFN11 at different developmental stages including PAX5 and histone modifiers.
We would like to thank Drs. A. Reddy and S. S. Dave (Duke University) for kindly providing access to the DLBCL database, Ms. F. Sasaki for technical assistance and Dr. M. Tomita for general support (Institute for Advanced Biosciences, Keio University) and Dr. H. Saya for kindly providing the vector for SLFN11 overexpression (Institute for Advanced Medical Research, Keio University School of Medicine). This work was partly conducted through the Joint Research Program of the Radiation Biology Center, Kyoto University.
14 Aug 2020
PONE-D-20-23146
Epigenetic suppression of SLFN11 in germinal center B cells in the process of the dynamic expression change during B-cell development
PLOS ONE
Dear Dr. Mural,
Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.
Specifically, both reviewers pointed out that the conclusions were not solidly supported by the data and the data were over-interpreted in multiple places.
Please submit your revised manuscript by 11/12/2020. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.
Please include the following items when submitting your revised manuscript:
If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.
If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols
We look forward to receiving your revised manuscript.
Kind regards,
Wei Xu
Academic Editor
PLOS ONE
Journal Requirements:
When submitting your revision, we need you to address these additional requirements.
1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at
https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and
2.PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.
In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.
3.Thank you for stating the following in the Competing Interests section:
[I have read the journal's policy and the authors of this manuscript have the following competing interests:
M.N. and A.T-K received honorarium and research funding from Eisai Co., Ltd. Other authors declare no conflicts of interest.].
Please confirm that this does not alter your adherence to all PLOS ONE policies on sharing data and materials, by including the following statement: "This does not alter our adherence to PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests). If there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.
Please include your updated Competing Interests statement in your cover letter; we will change the online submission form on your behalf.
Please know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: http://journals.plos.org/plosone/s/competing-interests
[Note: HTML markup is below. Please do not edit.]
Reviewers' comments:
Reviewer's Responses to Questions
Comments to the Author
1. Is the manuscript technically sound, and do the data support the conclusions?
The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.
Reviewer #1: Partly
Reviewer #2: Partly
**********
2. Has the statistical analysis been performed appropriately and rigorously?
Reviewer #1: N/A
Reviewer #2: Yes
**********
3. Have the authors made all data underlying the findings in their manuscript fully available?
The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.
Reviewer #1: No
Reviewer #2: Yes
**********
4. Is the manuscript presented in an intelligible fashion and written in standard English?
PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.
Reviewer #1: No
Reviewer #2: Yes
**********
5. Review Comments to the Author
Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)
Reviewer #1: SLFN11, a putative DNA/RNA helicase, has been implicated in DNA damage response to platinum-derivatives, topoisomerase inhibitors, PARP inhibitors and replication inhibitors. SLFN11 expression has been shown regulated by epigenetic modifications of DNA and histones in different cell types and tissues. In this paper, Fumiya Moribe et. al. investigated the regulatory mechanisms of SLFN11 expression and its potential roles in B cells by mining publicly available microarray gene expression data and experimentally tested the relationship between SLFN11 expression using IHC and cell viability. They found that SLFN11 expression is epigenetically regulated during B-cell differentiation, and it is typically suppressed in germinal center B cells(GCBs). Moreover, epigenetic activation of SLFN11 in lymphomas of GCB origin enhanced the susceptibility of lymphoma cells to a DNA-damaging agent.
Overall the experimental design is logical and the data analysis method is sound. A major weakness is that not all the data are supportive of their conclusions and some results appear to be preliminary and not validated experimentally. There are many grammar and spelling errors; the manuscript should be proofread by a native English speaker. In addition, the manuscript should be carefully revised to clarify the rationales and the results need to be interpreted properly. The specific comments are listed below:
1. Line 182-183, the results do not support this conclusion;
2. Figure 2: It needs to clarify how many samples were used in the IHC experiments. A statistical analysis should be performed with clearly labeled sample numbers. In addition, SLFN11 is also not expressed in B cells in Non-GCB regions. How SLFN11 expression is regulated in B cells in non-GCB regions should be explained.
3. The dynamic expression of SLFN11 during B cell development should be validated in both mouse or human samples using IHC.
4. Line 305-307, the results do not reconcile with this conclusion. To draw the conclusion, the authors should examine whether SLFN11 depletion can sensitize the cells to cytosine arabinoside(AraC).
5. Line 355-356, the results do not support this conclusion.
6. Figure 4. B the quality of Western blot result is poor. The bands of Actin and H3K9ac in FL318 cells are vague. RT-PCR results need to be statistically analyzed.
Reviewer #2: In this manuscript, the authors gave us a general investigation that SLFN11 was downregulated in germinal center B cells, and epigenetic modifiers EZH2 inhibitor and HDAC inhibitor could elevate its expression, which drove the cells more sensitive to cytosine arabinoside treatment.
Comments:
1. in the text, some of the conclusions were over interpreted, like line 182-183, line 262.
2. No any evidence to show the mechanism or SLFN11 downregulation;
3. Knockdown or overexpression of SLFN11 gene in ABC or GCB cell lines to study the sensitivity of these cells to arabinoside treatment.
**********
6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.
If you choose “no”, your identity will remain anonymous but your review may still be made public.
Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.
Reviewer #1: No
Reviewer #2: No
[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]
While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
Point-by-point answers to the reviewers
The list of changes and answers are indicated below with the comments of the reviewers included before our answers to facilitate the review process.
Reviewers' comments to the Author
Reviewer #1: SLFN11, a putative DNA/RNA helicase, has been implicated in DNA damage response to platinum-derivatives, topoisomerase inhibitors, PARP inhibitors and replication inhibitors. SLFN11 expression has been shown regulated by epigenetic modifications of DNA and histones in different cell types and tissues. In this paper, Fumiya Moribe et. al. investigated the regulatory mechanisms of SLFN11 expression and its potential roles in B cells by mining publicly available microarray gene expression data and experimentally tested the relationship between SLFN11 expression using IHC and cell viability. They found that SLFN11 expression is epigenetically regulated during B-cell differentiation, and it is typically suppressed in germinal center B cells(GCBs). Moreover, epigenetic activation of SLFN11 in lymphomas of GCB origin enhanced the susceptibility of lymphoma cells to a DNA-damaging agent.
Overall the experimental design is logical and the data analysis method is sound. A major weakness is that not all the data are supportive of their conclusions and some results appear to be preliminary and not validated experimentally. There are many grammar and spelling errors; the manuscript should be proofread by a native English speaker. In addition, the manuscript should be carefully revised to clarify the rationales and the results need to be interpreted properly.
(Answer) Thank you very much for your positive comments and constructive suggestions. In the revised manuscript, we added new data to consolidate our conclusions. They are included in the revised Figure 2 & Figures S2-S4 (dual immunohistochemical staining for SLFN11 and CD20/CD38/CD138/CD3), Figure 4A (DNA methylation plot for SLFN11 promoter) and Figure 5A (drug activity data for AraC across 39 B-cell-derived cancers). We have also carefully checked and edited our manuscript to clarify the rationale of our experiments and the interpretation of the results. Moreover, the revised manuscript has been proofread by a native English speaker. Thank you.
The specific comments are listed below:
1. Line 182-183, the results do not support this conclusion;
(Answer) Thank you for your suggestions. In the revised manuscript, we write “Thus, among SLFNs, SLFN11 uniquely showed parallel expression profile compared to PRDM1 and XBP1 and reverse expression profile with respect to PAX5 across B-cell development.” instead of the original sentence “Thus, SLFN11 but no other SLFNs expression can be controlled during B-cell development under the same regulatory system for PRDM1 and XBP1.”
2. Figure 2: It needs to clarify how many samples were used in the IHC experiments. A statistical analysis should be performed with clearly labeled sample numbers. In addition, SLFN11 is also not expressed in B cells in Non-GCB regions. How SLFN11 expression is regulated in B cells in non-GCB regions should be explained.
(Answer) Thank you very much for your suggestions. As suggested, in the revised manuscript, we increased the number of samples as well as B-cell markers to consolidate our conclusions. We employed six samples from three lymphatic tissue types (including each two lymph nodes, tonsils and spleen samples). In addition to the dual staining of CD20 (a marker of premature B cells) and SLFN11, we performed dual staining of CD38 and CD138 (markers of differentiated B-cells) with SLFN11 to determine SLFN11 expression in plasmablasts and plasmacytes. Overall, the results revealed that SLFN11 is downregulated in GCBs (CD20-positive cells in GCs) and is upregulated in plasmablasts (CD38-positive in GCs) and plasmacytes (CD38-positive and CD138-positive in cortex). We added these results in Figure 2A-C and Figure S2-4 in the revised manuscript. Moreover, we scored the SLFN11-positive population (%) to statistically support our findings by visual inspection. While only 0.8% of CD20-positive cells were SLFN11-positive, 89% and 77% of CD38-positive and CD138-positive cells, respectively, were SLFN11-positive (Figure 2D, **p<0.0001).
Additionally, to distinguish T-cells from B-cells, we performed dual staining for CD3 (a marker of T cells) and SLFN11. We found that 0.5% of CD3-positive cells were SLFN11-positive (Fig2B-D).
As for the upregulation of SLFN11 in non-GCB regions, we could not clarify the precise mechanism of the upregulation in this study. However, our data (Figs 3-5) imply that histone modification could be key for the regulation of SLFN11 in B-cells. This point has been included in our revised manuscript.
3. The dynamic expression of SLFN11 during B cell development should be validated in both mouse or human samples using IHC.
(Answer) Thank you. To validate the dynamic expression change of SLFN11 during B-cell development, we performed dual IHC with several markers for B-cells (Fig 2). Please see our answers to point # 2 above. Importantly, validation in mouse samples is currently not feasible as SLFN11 ortholog has not been identified among the different SLFN11 murine genes.
4. Line 305-307, the results do not reconcile with this conclusion. To draw the conclusion, the authors should examine whether SLFN11 depletion can sensitize the cells to cytosine arabinoside(AraC).
(Answer) Thank you for your suggestions. To answer your question, we worked hard to make SLFN11 KO cells in SU-DHL6 and other GCB cell lines. However, SU-DHL6 did not express SLFN11 high enough to be detected by WB under the treatments of epigenetic modifiers, and we were unable to validate candidate clones of SLFN11-KO. For follicular lymphoma cell lines, FL18, FL218 and FL318 did not form single colonies after the transfection of SLFN11-KO vectors. For these reasons, we have been unable to establish SLFN11-KO cell lines in the GCB cells used in this study. Alternatively, to examine the relationship between SLFN11 expression and sensitivity to AraC in GCB cells, we mined publicly available data on SLFN11 expression and drug activity of AraC. SLFN11 expression was found significantly correlated to the activity of AraC in B-cell-derived cancer cell lines. These data have been included in the revised Figure 5A. Moreover, we previously reported that the synergistic effect by the combination of HDACi and a DNA damaging agent (camptothecin) is SLFN11-dependent (i.e., the synergy was not observed in SLFN11-KO cells) (Tang SW, et al. Clin Cancer Res. 2018. [26]). Based on this, we conclude that activation of SLFN11 expression by epigenetic modifiers can enhance the activity of AraC. Nevertheless, since we failed to generate KO cells in GCB cells, we rephrased the original sentence and stated, “These results indicate that the combination of the epigenetic modifiers that enhance SLFN11 expression can improve the response in GCB lymphoma cells to AraC” in the revised manuscript.
5. Line 355-356, the results do not support this conclusion.
(Answer) An increased number of studies indicate that SLFN11 is a plausible target to sensitize tumor cells to cytotoxic chemotherapy (Coussy F, et al. Sci Transl Med. 2020 [17], Gardner EE, et al. Cancer Cell. 2017 [24], Nogales V, et al. Oncotarget. 2016 [25] and more). Hence, factors that regulate SLFN11 expression are legitimate therapeutic targets for further testing (Murai J, et al. Pharmacol Ther. 2019 [4] and Tang SW, et al. Clin Cancer Res. 2015 [52]). Therefore, at the end of the discussion of our revised manuscript, we would like to retain this point to foster future studies by independent investigators.
6. Figure 4. B the quality of Western blot result is poor. The bands of Actin and H3K9ac in FL318 cells are vague. RT-PCR results need to be statistically analyzed.
(Answer) Thank you for carefully examining our results. As suggested, we performed new Western blots and used better images in the revised manuscript (Fig 4C). Regarding RT-PCR, we performed t-test for all the genes in the heat map (Fig 4B) and added asterisks to represent the significant changes. We also omitted the bar-graphs for fold change of SLFN11 in Figure 4B right of the original manuscript to avoid showing redundant data.
Reviewer #2: In this manuscript, the authors gave us a general investigation that SLFN11 was downregulated in germinal center B cells, and epigenetic modifiers EZH2 inhibitor and HDAC inhibitor could elevate its expression, which drove the cells more sensitive to cytosine arabinoside treatment.
Comments:
1. in the text, some of the conclusions were over interpreted, like line 182-183, line 262.
(Answer) Thank you very much for these suggestions. Regarding the conclusions in lines 182-183, we revised the sentence to “Thus, among SLFNs, SLFN11 uniquely showed parallel expression profile compared to PRDM1 and XBP1 and reverse expression profile with respect to PAX5 across B-cell development.” For line 262, to avoid overinterpretation we revised the sentence to “These results consolidate the finding of differential expression of SLFN11 between ABC-DLBCL and GCB-DLBCL in clinical samples.”
2. No any evidence to show the mechanism of SLFN11 downregulation;
(Answer) Thank you for raising an important point. To determine whether epigenetics is a mechanism for SLFN11 downregulation, we examined the correlation between SLFN11 expression and DNA methylation level of the SLFN11 promoter in B-cell-derived malignancies. Overall, we observed a significant reverse correlation between SLFN11 expression and DNA methylation across B-cell derived cancers (revised Figure 4A). Interestingly, SLFN11 expression of GCB-DLBCL lines (▲) is suppressed without promoter DNA methylation, implying that histone modifications rather than DNA methylation are plausible suppressors of SLFN11 suppression in GCBs. Consistent with this possibility, we found that HDAC inhibitor or EZH2 inhibitor reactivate SLFN11 expression in GCB cells (revised Figure 4B-C).
3. Knockdown or overexpression of SLFN11 gene in ABC or GCB cell lines to study the sensitivity of these cells to arabinoside treatment.
(Answer)
Thank you for your suggestions. To answer your question, we worked hard to make SLFN11 KO cells in SU-DHL6 and other GCB cell lines. However, SU-DHL6 did not express SLFN11 high enough to be detected by WB under the treatments of epigenetic modifiers, and we were unable to validate candidate clones of SLFN11-KO. For follicular lymphoma cell lines, FL18, FL218 and FL318 did not form single colonies after the transfection of SLFN11-KO vectors. For these reasons, we have been unable to establish SLFN11-KO cell lines in the GCB cells used in this study. Alternatively, to relate SLFN11 expression with the activity of AraC in GCB cells, we mined publicly available data on SLFN11 expression and drug activity of AraC. SLFN11 expression was found significantly correlated to the activity of AraC in B-cell-derived cancer cell lines. These data have been included in the revised Figure 5A. This result is consistent with a previous report showing that the synergistic combination of HDACi with the replication selective DNA damaging agents (camptothecin) is SLFN11-dependent (i.e., the synergy was not observed in SLFN11-KO cells) (Tang SW, et al. Clin Cancer Res. 2018. [26]). Based on these observations, we consider that activation of SLFN11 expression by epigenetic modifiers can enhance the activity of AraC. Nevertheless, since we failed to generate KO or OE cells in GCB cells, we rephrased our conclusion in the revised manuscript and stated, “These results indicate that the combination of the epigenetic modifiers that enhance SLFN11 expression can improve the response in GCB lymphoma cells to AraC.”
23 Nov 2020
PONE-D-20-23146R1
Epigenetic suppression of SLFN11 in germinal center B-cells during B-cell development
PLOS ONE
Dear Dr. Murai,
Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.
Reviewer one requested repeating of WB of SLFN11 and performed overexpression or knockdown of SLFN11.
Please submit your revised manuscript by 2/1/2021. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.
Please include the following items when submitting your revised manuscript:
If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.
If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols
We look forward to receiving your revised manuscript.
Kind regards,
Wei Xu
Academic Editor
PLOS ONE
[Note: HTML markup is below. Please do not edit.]
Reviewers' comments:
Reviewer's Responses to Questions
Comments to the Author
1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.
Reviewer #1: (No Response)
Reviewer #2: All comments have been addressed
**********
2. Is the manuscript technically sound, and do the data support the conclusions?
The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.
Reviewer #1: Partly
Reviewer #2: Yes
**********
3. Has the statistical analysis been performed appropriately and rigorously?
Reviewer #1: Yes
Reviewer #2: Yes
**********
4. Have the authors made all data underlying the findings in their manuscript fully available?
The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.
Reviewer #1: Yes
Reviewer #2: Yes
**********
5. Is the manuscript presented in an intelligible fashion and written in standard English?
PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.
Reviewer #1: Yes
Reviewer #2: Yes
**********
6. Review Comments to the Author
Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)
Reviewer #1: SLFN11 plays key role in execute cancer cells harboring replicative stress induced by DNA damaging agents while the roles of SLFN11 under physiological conditions are not widely studied. B-cells undergo gene editing at variable regions of the immunoglobulin gene loci during the development and maturation. During this process, B-cells are physiologically exposed to genotoxic stress caused by somatic hypermutations and class-switch recombination. Such genotoxic tress is introduced particularly to centroblasts and centrocytes in germinal centers (GCs) of lymph nodes. Thus, Germinal center B-cells (GCBs) undergo somatic hypermutations and class-switch recombination, which can cause physiological genotoxic stress. Hence, Fumiya Moribe etal tested whether the expression of SLFN11 is needed to be controlled during B-cell development to avoid SLFN11- dependent cell death in cells undergoing genomic rearrangements. They performed several mRNA and Protein expression analysis on SLFN11 by using cell lines of different stages of normal B cells and various types of B-cell lymphoma or normal human lymphatic tissues and some Cell viability experiments and found the following results: SLFN11 mRNA level was low in both normal GCBs and GCB-DLBCL (GCB like-diffuse large 4 B-cell lymphoma). Low SLFN11 expression in GCBs and high SLFN11 expression in plasmablasts and plasmacytes. The EZH2 and HDAC epigenetic modifiers upregulated SLFN11 expression in GCB-derived lymphomas and made them more susceptible to cytosine arabinoside. Overall the experimental designs are logical and some data mincing are meaningful. The major concern is that the article is focus on the expression and function of SLFN11 during B cell development, especially in the GCB-derived lymphomas and their susceptibility to cytosine arabinoside. Therefore, SLFN11 knock down or overexpression in some of these cells are necessary for further studying. A few minor comments are listed below:
1. Figure 4C, the western blot bands are not clear. Especially H3K9AC. The right SLFN11 band should be divided with the non specific bands by extending the running time of SDS page gels.
2. Figure 5, SLFN11 should be knockdown by shRNA (SiRNA) or overexpressed in ABC or GCB cell lines to study the sensitivity of these cells to arabinoside treatment.
Reviewer #2: (No Response)
**********
7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.
If you choose “no”, your identity will remain anonymous but your review may still be made public.
Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.
Reviewer #1: No
Reviewer #2: No
[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]
While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
Point-by-point answers to the reviewers
The list of changes and answers are indicated below with the comments of the reviewers included before our answers to facilitate the review process.
Reviewers' comments to the Author
Reviewer #1: SLFN11 plays key role in execute cancer cells harboring replicative stress induced by DNA damaging agents while the roles of SLFN11 under physiological conditions are not widely studied. B-cells undergo gene editing at variable regions of the immunoglobulin gene loci during the development and maturation. During this process, B-cells are physiologically exposed to genotoxic stress caused by somatic hypermutations and class-switch recombination. Such genotoxic tress is introduced particularly to centroblasts and centrocytes in germinal centers (GCs) of lymph nodes. Thus, Germinal center B-cells (GCBs) undergo somatic hypermutations and class-switch recombination, which can cause physiological genotoxic stress. Hence, Fumiya Moribe etal tested whether the expression of SLFN11 is needed to be controlled during B-cell development to avoid SLFN11- dependent cell death in cells undergoing genomic rearrangements. They performed several mRNA and Protein expression analysis on SLFN11 by using cell lines of different stages of normal B cells and various types of B-cell lymphoma or normal human lymphatic tissues and some Cell viability experiments and found the following results: SLFN11 mRNA level was low in both normal GCBs and GCB-DLBCL (GCB like-diffuse large 4 B-cell lymphoma). Low SLFN11 expression in GCBs and high SLFN11 expression in plasmablasts and plasmacytes. The EZH2 and HDAC epigenetic modifiers upregulated SLFN11 expression in GCB-derived lymphomas and made them more susceptible to cytosine arabinoside. Overall the experimental designs are logical and some data mincing are meaningful. The major concern is that the article is focus on the expression and function of SLFN11 during B cell development, especially in the GCB-derived lymphomas and their susceptibility to cytosine arabinoside. Therefore, SLFN11 knock down or overexpression in some of these cells are necessary for further studying. A few minor comments are listed below:
1. Figure 4C, the western blot bands are not clear. Especially H3K9AC. The right SLFN11 band should be divided with the non specific bands by extending the running time of SDS page gels.
(Answer) Thank you for carefully examining our results. As suggested, we repeated the western blot for FL218 for multiple times. However, due to the very low expression of SLFN11 in FL218, we were unable to divide the SLFN11 band from the non-specific band. Thus, we tried to test SLFN11 protein level in another cell line. We could observe SLFN11 bands in FL18 and its upregulation by HDACi, which is consistent with the qPCR results. Hence, we included the western blot results of FL18 and excluded those of FL218 in the updated manuscript. As for the blot of H3K9Ac, we confirmed that HDACi but not EZH2 inhibitor increased the acetylation level of H3K9, which is reasonable since HDACi targets broad acetylation sites of histones while EZH2 inhibitor targets exclusively H3K27. Hence, we keep the previous blot of H3K9Ac in FL318 and added a comparable result of FL18.
2. Figure 5, SLFN11 should be knockdown by shRNA (SiRNA) or overexpressed in ABC or GCB cell lines to study the sensitivity of these cells to arabinoside treatment.
(Answer) Thank you very much for your suggestions. We generated SLFN11-overexpressing SU-DHL6 cell line by using piggy back tetON system (SU-DHL6 tetON SLFN11 cells). In this system, we were able to induce SLFN11 expression when treating the cells with doxycycline. SLFN11 induction in SU-DHL6 tetON SLFN11 cells was confirmed by western blot and immunofluorescence (Fig5D). Using this cell line, we examined whether SLFN11 sensitizes the cells to DNA damaging agents. We treated SU-DHL6 tetON SLFN11 cells with arabinoside (AraC) and observed that SU-DHL6 tetON SLFN11 cells were more sensitive to AraC (Fig 5E left).
We also found SLFN11 expression was correlated to the activity of camptothecin (CPT) in B-cell cancer cell lines in the GDSC database (Fig5A right). SLFN11 overexpression sensitized the cells to CPT as well (Fig5E right). To consolidate the role of SLFN11 in cellular sensitivity to DNA damaging agents in GCBs, we included these data in the revised manuscript.
8 Dec 2020
Epigenetic suppression of SLFN11 in germinal center B-cells during B-cell development
PONE-D-20-23146R2
Dear Dr. Mural,
We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.
Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.
An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.
If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.
Kind regards,
Wei Xu
Academic Editor
PLOS ONE
20 Jan 2021
PONE-D-20-23146R2
Epigenetic suppression of SLFN11 in germinal center B-cells during B-cell development
Dear Dr. Murai:
I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.
If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.
If we can help with anything else, please email us at plosone@plos.org.
Thank you for submitting your work to PLOS ONE and supporting open access.
Kind regards,
PLOS ONE Editorial Office Staff
on behalf of
Dr. Wei Xu
Academic Editor
PLOS ONE
Tweets
Epigenetic suppression of SLFN11 in germinal center B-cells during B-cell development
Twitter
Facebook
WhatsApp
LinkedIn
